Mature sequence rno-miR-292-5p

Accession numberMIMAT0000896
IDrno-miR-292-5p
Stem-Loop rno-mir-292
Sequence
acucaaacugggggcucuuuug
Get sequence
Deep sequencing166 reads, 45 experiments
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).