Mature sequence cbr-miR-355

Accession numberMIMAT0001319
IDcbr-miR-355
Stem-Loop cbr-mir-355
Sequence
uuuguuuuagccugagcuaug
Get sequence
Deep sequencing reads, experiments

References

1