Mature sequence bta-miR-331-3p

Accession numberMIMAT0004339
IDbta-miR-331-3p
Stem-Loop bta-mir-331
Sequence
gccccugggccuauccuagaa
Get sequence
Deep sequencing11923 reads, 71 experiments
Predicted targets

References

1
2