Mature sequence bta-miR-1343-3p

Accession numberMIMAT0011840
IDbta-miR-1343-3p
Previous IDsbta-miR-1343*
Stem-Loop bta-mir-1343
Sequence
cuccuggggcccgcacucuc
Get sequence
Deep sequencing1629 reads, 69 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).