Mature sequence cin-miR-92a-5p

Accession numberMIMAT0015253
IDcin-miR-92a-5p
Previous IDscin-miR-92a*
Stem-Loop cin-mir-92a
Sequence
cggcugguacaagagcacga
Get sequence
Deep sequencing102 reads, 2 experiments

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3