Mature sequence pxy-miR-2a-3p

Accession numberMIMAT0033718
IDpxy-miR-2a-3p
Stem-Loop pxy-mir-2a
Sequence
uaucacagccagcuuuguugacu
Get sequence
Deep sequencing106 reads, 4 experiments

References

1