Stem-loop gma-MIR396b

Accession

MI0001786

Description

Glycine max gma-MIR396b precursor miRNA

Literature search

27 open access papers mention gma-MIR396b
(175 sentences)

Sequence

cucaaguccuggucaugcuuUUCCACAGCUUUCUUGAACUUcuuaugcaucuuauaucucuccaccuccaggauuuuaagcccuagaaGCUCAAGAAAGCUGUGGGAGAauauggcaauucaggcu
....((.((((((((((.(((((((((((((((((((.(((((...((.......(((.((........))))).....))...))))).))))))))))))))))))).))))))....))))))

Structure

cuca  u    ----      c                   A     uau  aucuuau   u  cca 
    ag ccug    gucaug uuUUCCACAGCUUUCUUGA CUUcu   gc       auc cu   c
    || ||||    |||||| ||||||||||||||||||| |||||   ||       ||| ||    
    uc ggac    cgguau AGAGGGUGUCGAAAGAACU Gaaga   cg       uag ga   c
----  -    uuaa      a                   C     ucc  --aauuu   -  ccu 

Annotation confidence Not enough data

Genome context

chr13: 27517027-27517152 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from gma-MIR396b

Mature gma-miR396b-5p

• Accession: MIMAT0001688
• Description: Glycine max gma-miR396b-5p mature miRNA
• Sequence: 21 - UUCCACAGCUUUCUUGAACUU - 41
• Evidence: experimental ; 454 [1], Illumina [3]

Mature gma-miR396b-3p

• Accession: MIMAT0020923
• Description: Glycine max gma-miR396b-3p mature miRNA
• Sequence: 89 - GCUCAAGAAAGCUGUGGGAGA - 109
• Evidence: experimental ; Illumina [3-4]

References

1. Conservation and divergence of microRNA families in plants
   "Dezulian T, Palatnik JF, Huson DH, Weigel D"
   Genome Biol. (2005) 6:P13


2. PubMed ID: 18402695
   Novel and nodulation-regulated microRNAs in soybean roots
   Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
   BMC Genomics (2008) 9:160


3. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


4. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553