![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR396b |
||||||
Accession | MI0001786 (change log) | |||||
Description | Glycine max miR396b stem-loop | |||||
Gene family | MIPF0000047; MIR396 | |||||
Literature search |
![]()
27 open access papers mention gma-MIR396b | |||||
Stem-loop |
cuca u ---- c a uau aucuuau u cca 5' ag ccug gucaug uuuuccacagcuuucuuga cuucu gc auc cu c || |||| |||||| ||||||||||||||||||| ||||| || ||| || 3' uc ggac cgguau agagggugucgaaagaacu gaaga cg uag ga c ---- - uuaa a c ucc --aauuu - ccu |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence gma-miR396b-5p |
|
Accession | MIMAT0001688 |
Previous IDs | gma-miR396b |
Sequence |
21 - uuccacagcuuucuugaacuu - 41 |
Evidence | experimental; 454 [1], Illumina [3] |
Mature sequence gma-miR396b-3p |
|
Accession | MIMAT0020923 |
Sequence |
89 - gcucaagaaagcugugggaga - 109 |
Evidence | experimental; Illumina [3-4] |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
4 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|