Stem-loop osa-MIR1423

Accession

MI0006963

Description

Oryza sativa osa-MIR1423 precursor miRNA

Literature search

4 open access papers mention osa-MIR1423
(8 sentences)

Sequence

806 reads, 587 reads per million, 2 experiments

gcacaacacuaguauuugggAGGCAACUACACGUUGGGCGCUCGauccaggggugggaaaaucgggcgcccacguuuuccccacccccggaucgAGCGCCCAAGCGGUAGUUGUCucccaaauacuugugcugugc
(((((.(((.((((((((((((((((((((.(((((((((((((((((.((((((((.(((.((((...)).)).))).)))))))).))))))))))))).)))))))))))))))))))))))).))).)))))

Structure

     a   u                    A    -             a        a   u  -  c 
gcaca cac aguauuugggAGGCAACUAC CGUU GGGCGCUCGaucc gggguggg aaa cg gg  
||||| ||| |||||||||||||||||||| |||| ||||||||||||| |||||||| ||| || || g
cgugu gug ucauaaacccuCUGUUGAUG GCGA CCCGCGAgcuagg ccccaccc uuu gc cc  
     c   u                    -    A             c        c   u  a  c 

Annotation confidence Low

Genome context

Chr4: 19715117-19715252 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from osa-MIR1423

Mature osa-miR1423-5p

• Accession: MIMAT0015244
• Description: Oryza sativa osa-miR1423-5p mature miRNA
• Sequence: 21 - AGGCAACUACACGUUGGGCGCUCG - 44
• Evidence: experimental ; Illumina [3], 454 [4]

Mature osa-miR1423-3p

• Accession: MIMAT0005957
• Description: Oryza sativa osa-miR1423-3p mature miRNA
• Sequence: 95 - AGCGCCCAAGCGGUAGUUGUC - 115
• Evidence: experimental ; MPSS [1], Northern [1], cloned [2], Illumina [3]

References

1. PubMed ID: 18312648
   Identification of novel and candidate miRNAs in rice by high throughput sequencing
   Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK
   BMC Plant Biol (2008) 8:25


2. PubMed ID: 19903869
   Rice MicroRNA effector complexes and targets
   "Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y"
   "Plant Cell (2009) 21:3421-3435


3. PubMed ID: 18353984
   Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)
   "Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ"
   "Proc Natl Acad Sci U S A (2008) 105:4951-4956


4. PubMed ID: 18687877
   A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains
   "Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C"
   "Genome Res (2008) 18:1456-1465