Stem-loop sequence gma-MIR482a

AccessionMI0007218 (change log)
Previous IDsgma-MIR482
DescriptionGlycine max miR482a stem-loop
Gene family MIPF0000403; MIR482
Literature search

22 open access papers mention gma-MIR482a
(54 sentences)

Stem-loop 
         u ug           -u          c   -gu    ugg 
5' ucagaa u  ugggaaugggc  gauugggaag aau   gugc   u
   |||||| |  |||||||||||  |||||||||| |||   ||||   g
3' agucuu a  auccuuacccg  uuaacccuuc uua   uacg   c
         u gu           cc          u   auu    uaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 7873063-7873157 [+]
intergenic
Database links

Mature sequence gma-miR482a-5p

Accession MIMAT0017337
Sequence

3 -  

agaauuugugggaaugggcuga

 - 24

Get sequence
Evidence experimental; Illumina [2,4-5], 454 [3]

Mature sequence gma-miR482a-3p

Accession MIMAT0007364
Previous IDsgma-miR482
Sequence

62 -  

ucuucccaauuccgcccauuccua

 - 85

Get sequence
Evidence experimental; 454 [1,3]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
5
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).