![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR482a |
|||||
Accession | MI0007218 (change log) | ||||
Previous IDs | gma-MIR482 | ||||
Description | Glycine max miR482a stem-loop | ||||
Gene family | MIPF0000403; MIR482 | ||||
Literature search |
![]()
22 open access papers mention gma-MIR482a | ||||
Stem-loop |
u ug -u c -gu ugg 5' ucagaa u ugggaaugggc gauugggaag aau gugc u |||||| | ||||||||||| |||||||||| ||| |||| g 3' agucuu a auccuuacccg uuaacccuuc uua uacg c u gu cc u auu uaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR482a-5p |
|
Accession | MIMAT0017337 |
Sequence |
3 - agaauuugugggaaugggcuga - 24 |
Evidence | experimental; Illumina [2,4-5], 454 [3] |
Mature sequence gma-miR482a-3p |
|
Accession | MIMAT0007364 |
Previous IDs | gma-miR482 |
Sequence |
62 - ucuucccaauuccgcccauuccua - 85 |
Evidence | experimental; 454 [1,3] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
3 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
4 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
5 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|