miRBase entry: gma-MIR1508a

Stem-loop gma-MIR1508a


Accession
MI0007220
Description
Glycine max gma-MIR1508a precursor miRNA
Gene family
MIPF0000719; MIR1508

Literature search
10 open access papers mention gma-MIR1508a
(24 sentences)

Sequence

aauugcuauccaacugcuauucccauuucuaaaccuuguuacacgagcaucuugaucaauggUCUAGAAAGGGAAAUAGCAGUUGaguggugcuu
....(((((.((((((((((((((.((((((.((((((.....((((...))))..))).))).))))))))).))))))))))).)))))....

Structure
aauu     c           -   a      a   -   uuaca    c 
    gcuau caacugcuauu ccc uuucua acc uug     cgag  
    ||||| ||||||||||| ||| |||||| ||| |||     |||| a
    uggug GUUGACGAUAA GGG AAAGAU Ugg aac     guuc  
uucg     a           A   -      C   u   ---ua    u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr16: 33378856-33378950 [+]

Database links

Mature gma-miR1508a

Accession MIMAT0007366
Description Glycine max gma-miR1508a mature miRNA
Sequence 63 - UCUAGAAAGGGAAAUAGCAGUUG - 85
Evidence experimental
454 [1,3], Northern [1], cloned [2], Illumina [4]

References

  1. PubMed ID: 18402695
    Novel and nodulation-regulated microRNAs in soybean roots
    Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
    BMC Genomics (2008) 9:160

  2. PubMed ID: 19084500
    Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules
    "Wang Y, Li P, Cao X, Wang X, Zhang A, Li X"
    "Biochem Biophys Res Commun (2009) 378:799-803

  3. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  4. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553