Stem-loop sequence gma-MIR1508a

AccessionMI0007220 (change log)
Previous IDsgma-MIR1508
DescriptionGlycine max miR1508a stem-loop
Gene family MIPF0000719; MIR1508
Literature search

10 open access papers mention gma-MIR1508a
(24 sentences)

Stem-loop
   aauu    uc           -   a      a   -   uuaca      
5'     gcua  caacugcuauu ccc uuucua acc uug     cgagc 
       ||||  ||||||||||| ||| |||||| ||| |||     |||| a
3'     uggu  guugacgauaa ggg aaagau ugg aac     guucu 
   uucg    ga           a   -      c   u   ---ua      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 33378856-33378950 [+]
intergenic
Database links

Mature sequence gma-miR1508a

Accession MIMAT0007366
Previous IDsgma-miR1508
Sequence

63 - 

ucuagaaagggaaauagcaguug

 - 85

Get sequence
Evidence experimental; 454 [1,3], Northern [1], cloned [2], Illumina [4]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).