miRBase entry: gma-MIR1510a

Stem-loop gma-MIR1510a


Accession
MI0007222
Description
Glycine max gma-MIR1510a precursor miRNA
Gene family
MIPF0000703; MIR1510

Literature search
17 open access papers mention gma-MIR1510a
(42 sentences)

Sequence

uuauggaacuggAGGGAUAGGUAAAACAAUGACUGCuguauaaguaauuguuauaguuagUUGUUGUUUUACCUAUUCCACCCauuccaugua
.(((((((..((.((((((((((((((((((((((((((((((....))).))))).)))))))))))))))))))))).))..)))))))..

Structure
-u       cu  A                      -     -   g 
  uauggaa  gg GGGAUAGGUAAAACAAUGACUG Cugua uaa u
  |||||||  || |||||||||||||||||||||| ||||| |||  
  guaccuu  CC CCUUAUCCAUUUUGUUGUUgau gauau guu a
au       aC  A                      u     u   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr16: 31887382-31887474 [+]

Database links

Mature gma-miR1510a-5p

Accession MIMAT0017338
Description Glycine max gma-miR1510a-5p mature miRNA
Sequence 13 - AGGGAUAGGUAAAACAAUGACUGC - 36
Evidence experimental
Illumina [3,5], 454 [4]

Mature gma-miR1510a-3p

Accession MIMAT0007368
Description Glycine max gma-miR1510a-3p mature miRNA
Sequence 61 - UUGUUGUUUUACCUAUUCCACCC - 83
Evidence experimental
454 [1,4], Northern [1], cloned [2], Illumina [6]

References

  1. PubMed ID: 18402695
    Novel and nodulation-regulated microRNAs in soybean roots
    Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
    BMC Genomics (2008) 9:160

  2. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14

  3. PubMed ID: 19084500
    Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules
    "Wang Y, Li P, Cao X, Wang X, Zhang A, Li X"
    "Biochem Biophys Res Commun (2009) 378:799-803

  4. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  5. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  6. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153