Stem-loop sequence gma-MIR1510a

AccessionMI0007222 (change log)
Previous IDsgma-MIR1510
DescriptionGlycine max miR1510a stem-loop
Gene family MIPF0000703; MIR1510
Literature search

17 open access papers mention gma-MIR1510a
(42 sentences)

Stem-loop
   -u       cu  a                ug    -     -   g 
5'   uauggaa  gg gggauagguaaaacaa  acug cugua uaa u
     |||||||  || ||||||||||||||||  |||| ||||| |||  
3'   guaccuu  cc ccuuauccauuuuguu  ugau gauau guu a
   au       ac  a                gu    u     u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 31887382-31887474 [+]
intergenic
Database links

Mature sequence gma-miR1510a-5p

Accession MIMAT0017338
Sequence

13 - 

agggauagguaaaacaaugacugc

 - 36

Get sequence
Evidence experimental; Illumina [3,5], 454 [4]

Mature sequence gma-miR1510a-3p

Accession MIMAT0007368
Previous IDsgma-miR1510;gma-miR1510a
Sequence

61 - 

uuguuguuuuaccuauuccaccc

 - 83

Get sequence
Evidence experimental; 454 [1,4], Northern [1], cloned [2], Illumina [6]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
4
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
5
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
6