|
miRBase |
|
Stem-loop sequence osa-MIR2871a |
|||||
| Accession | MI0013035 | ||||
| Description | Oryza sativa miR2871a stem-loop | ||||
| Gene family | MIPF0000986; MIR2871 | ||||
| Stem-loop |
----- u c aa --------a - cuuu ca ggugaccguagaaacuag auagaaaa guag uaucucaa guga g || |||||||||||||||||| |||||||| |||| |||||||| |||| gu ucacugguaucuuugauu uaucuuuu cauc auaggguu cauu u cggug u u -c aaugaacag g uacu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence osa-miR2871a-5p |
|
| Accession | MIMAT0020948 |
| Sequence |
7 - gaccguagaaacuagcauagaaaa - 30 |
| Deep sequencing | 557 reads, 2 experiments |
| Evidence | experimental; Solexa [2-4] |
Mature sequence osa-miR2871a-3p |
|
| Accession | MIMAT0013820 |
| Previous IDs | osa-miR2871a |
| Sequence |
92 - uauuuuaguuucuauggucac - 112 |
| Deep sequencing | 128 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:19903869
"Rice MicroRNA effector complexes and targets"
Plant Cell. 21:3421-3435(2009).
|
| 2 |
PMID:21525786
"Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus"
RNA Biol. 8:538-547(2011).
|
| 3 |
PMID:21791435
"Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)"
J Exp Bot. 62:4943-4954(2011).
|
| 4 | |