Stem-loop sequence aae-mir-375

AccessionMI0013504 (change log)
DescriptionAedes aegypti miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

5 open access papers mention aae-mir-375
(7 sentences)

Stem-loop
   ---u           aguu   ua    c    u   ga    ugaa    -aau    uuc 
5'     ggaagaauccg    acu  agcc aacg aca  aacu    ucug    gccg   u
       |||||||||||    |||  |||| |||| |||  ||||    ||||    ||||    
3'     ucuucuuaggc    uga  ucgg uugc ugu  uuga    agau    cggu   a
   cuag           guau   gc    u    u   --    ----    cguu    uag 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.309: 1318735-1318850 [-]
intergenic
Database links

Mature sequence aae-miR-375

Accession MIMAT0014298
Sequence

78 - 

uuuguucguuuggcucgaguua

 - 99

Get sequence
Deep sequencing42 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).