Stem-loop sequence cqu-mir-100

AccessionMI0013585 (change log)
DescriptionCulex quinquefasciatus miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -aaca  a   ----      u      a      g     aa      c  cccu 
5'      gc uuu    cccauu gcggga cccgua auccg  cuugug ug    u
        || |||    |||||| |||||| |||||| |||||  |||||| ||    u
3'      cg aaa    ggguag cguccu ggguau uaggc  gaacau gc    u
   agcua  a   aggu      c      a      a     cg      u  acau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.4: 271392-271501 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-100
cqu-mir-100supercont3.4: 271392-271501 [+]
cqu-let-7supercont3.4: 280595-280685 [+]
cqu-mir-125supercont3.4: 280955-281049 [+]
Database links

Mature sequence cqu-miR-100-5p

Accession MIMAT0014387
Previous IDscqu-miR-100
Sequence

23 - 

aacccguagauccgaacuugug

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-100-3p

Accession MIMAT0014388
Previous IDscqu-miR-100*
Sequence

64 - 

caaggccggauauaugggauc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).