Stem-loop sequence cqu-mir-2941-1

AccessionMI0013622 (change log)
DescriptionCulex quinquefasciatus miR-2941-1 stem-loop
Gene family MIPF0000842; mir-2941
Literature search

1 open access papers mention cqu-mir-2941-1
(11 sentences)

Stem-loop
   uac      -ug          g    uug      
5'    ccgugg   uuuagucgua ugca   guuuu 
      ||||||   |||||||||| ||||   |||| u
3'    ggcacc   agaucggcau augu   caaga 
   aua      uca          g    ---      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.5: 753640-753706 [-]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-2941-1
cqu-mir-2952supercont3.5: 753920-753983 [-]
cqu-mir-2941-2supercont3.5: 753788-753868 [-]
cqu-mir-2941-1supercont3.5: 753640-753706 [-]
Database links

Mature sequence cqu-miR-2941-1-5p

Accession MIMAT0014434
Previous IDscqu-miR-2941-1*
Sequence

5 - 

cgugguguuuagucguagugc

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-2941-3p

Accession MIMAT0014435
Previous IDscqu-miR-2941
Sequence

43 - 

uaguacggcuagaacuccacgg

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).