Stem-loop sequence tgu-mir-29a-2

AccessionMI0013746 (change log)
DescriptionTaeniopygia guttata miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention tgu-mir-29a-2
(3 sentences)

Stem-loop
   ---------           ucu       ---     uc 
5'          ugaccgauuuc   ugguguu   cagag  u
            |||||||||||   |||||||   |||||  c
3'          auuggcuaaag   accacga   guuuu  a
   ggauguagu           uuu       ucu     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr26: 3761359-3761429 [+]
sense
ENSTGUT00000018328 ; tgu-mir-29a-2-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-29a-2
tgu-mir-29b-2chr26: 3760396-3760466 [+]
tgu-mir-29a-2chr26: 3761359-3761429 [+]
Database links

Mature sequence tgu-miR-29a-2-5p

Accession MIMAT0031063
Sequence

1 - 

ugaccgauuucucuugguguuc

 - 22

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-29a-3p

Accession MIMAT0014532
Sequence

41 - 

uagcaccauuugaaaucgguu

 - 61

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).