Stem-loop sequence pma-let-7a-2

AccessionMI0017145 (change log)
DescriptionPetromyzon marinus let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -uga    -   c     u   gu                ucaggguc  a   a 
5'     gugc gcc uggga gag  aguagguuguauaguu        ac ccc a
       |||| ||| ||||| |||  ||||||||||||||||        || ||| a
3'     cacg cgg acccu uuc  ucaucuaacaugucaa        ug ggg c
   gucg    g   a     -   uc                -------u  a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-let-7a

Accession MIMAT0019564
Sequence

17 - 

ugagguaguagguuguauaguu

 - 38

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).