Stem-loop sequence hco-mir-43

AccessionMI0020012 (change log)
DescriptionHaemonchus contortus miR-43 stem-loop
Literature search

1 open access papers mention hco-mir-43
(12 sentences)

Stem-loop
   ----acuuauuc     uc  -     a        ua     u     gc u 
5'             gcuga  uu cuugc acccgaug  gcugu auacu  c c
               |||||  || ||||| ||||||||  ||||| |||||  | g
3'             cgacu  ag gaacg uggguuac  ugaca uauga  g u
   cccaguuacguu     cu  c     c        ug     c     au u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-43

Accession MIMAT0023336
Sequence

58 - 

uaucacagugucauugggucgca

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).