Stem-loop sequence hco-mir-5899

AccessionMI0020019 (change log)
DescriptionHaemonchus contortus miR-5899 stem-loop
Literature search

1 open access papers mention hco-mir-5899
(1 sentences)

Stem-loop
   -----c uc  u u  -u         a         --    c  u     u  u 
5'       g  ug g ga  ucauacagc caggcuaug  cauu cg gugca uu c
         |  || | ||  ||||||||| |||||||||  |||| || ||||| || u
3'       c  au c cu  agugugucg guucgauac  guaa gc caugu ag a
   uucuua uu  c u  uc         a         au    u  c     c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5899

Accession MIMAT0023344
Sequence

58 - 

uacccguaauguacauagcuugag

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).