Stem-loop sequence hco-mir-87b

AccessionMI0020024 (change log)
DescriptionHaemonchus contortus miR-87b stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention hco-mir-87b
(1 sentences)

Stem-loop
   ------uacccuaua       u  au  -       c    ga   aa    - au 
5'                aggaugg cc  cc cgccuga acuu  cuc  accu c  u
                  ||||||| ||  || ||||||| ||||  |||  |||| |  u
3'                uccuauc gg  gg guggacu ugaa  gag  ugga g  a
   gnnnnnnnnnnuaga       c  -c  u       c    ac   --    a aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-87b

Accession MIMAT0023349
Sequence

59 - 

gugagcaaagucucaggugugg

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).