Stem-loop sequence sly-MIR394

AccessionMI0029102 (change log)
DescriptionSolanum lycopersicum miR394 stem-loop
Gene family MIPF0000100; MIR394
Literature search

7 open access papers mention sly-MIR394
(35 sentences)

Stem-loop
   caauc     uu   u         u       uuc  u      u   -      u c           uuuaccuucauaaucuucu       u           uu 
5'      uugau  uca gaagauuuc caaaggg   cu acauag ucu uuggca u uguccaccucc                   auuuuuu agaaaaauaau  u
        |||||  ||| ||||||||| |||||||   || |||||| ||| |||||| | |||||||||||                   ||||||| |||||||||||  u
3'      aauug  agu cuucuaaag guuucuc   ga uguguu aga aacugu a acggguggagg                   uaaaaaa uuuuuuuauua  g
   --guu     -u   u         u       uuu  u      u   c      c u           -------------------       u           uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr4: 65891077-65891276 [+]
intergenic
Database links

Mature sequence sly-miR394-5p

Accession MIMAT0035437
Sequence

50 - 

uuggcauucuguccaccucc

 - 69

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR394-3p

Accession MIMAT0035438
Sequence

136 - 

aggugggcauacugucaaca

 - 155

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).