Stem-loop sequence dsi-mir-2498c

AccessionMI0030849 (change log)
DescriptionDrosophila simulans miR-2498c stem-loop
Stem-loop
   --a            u -u        u 
5'    uaaguauguuau c  auuuugug g
      |||||||||||| |  |||||||| u
3'    auucguacaaug g  uaaaacau u
   aua            u uc        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 15134038-15134093 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-2498c
dsi-mir-992chr2R: 15134519-15134598 [-]
dsi-mir-991chr2R: 15134391-15134508 [-]
dsi-mir-2498cchr2R: 15134038-15134093 [-]
dsi-mir-2498achr2R: 15133881-15133941 [-]
dsi-mir-2498bchr2R: 15133515-15133573 [-]
dsi-mir-313chr2R: 15132988-15133053 [-]
dsi-mir-312chr2R: 15132849-15132914 [-]
dsi-mir-311chr2R: 15132682-15132767 [-]
dsi-mir-310chr2R: 15132557-15132645 [-]
Database links

Mature sequence dsi-miR-2498c-5p

Accession MIMAT0039103
Sequence

1 - 

auaaguauguuauucuauuuug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-2498c-3p

Accession MIMAT0039104
Sequence

36 - 

aucuguguaacaugcuuaaua

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).