Accession | MIMAT0000069 |
Description | hsa-miR-16-5p mature miRNA |
Hairpins | |
Sequence | UAGCAGCACGUAAAUAUUGGCG |
Evidence |
experimental
cloned [1,3-4,6-8], Northern [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0001569 branching involved in blood vessel morphogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23083510 | occurs_in UBERON:0007777 |
acts_upstream_of | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23083510 | results_in_movement_of CL:0002618 |
acts_upstream_of | GO:1900747 negative regulation of vascular endothelial growth factor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23083510 | |
acts_upstream_of | GO:1901164 negative regulation of trophoblast cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23083510 | |
acts_upstream_of | GO:2000134 negative regulation of G1/S transition of mitotic cell cycle |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23083510 | occurs_in CL:0000134 |
acts_upstream_of_or_within | GO:2000752 regulation of glucosylceramide catabolic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25584808 | occurs_in CL:0000057 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26440600 | has_input UniProtKB:P05067 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26440600 | has_input UniProtKB:P56817 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26440600 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15131085 | has_input UniProtKB:Q9BW30 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16166262 | has_input UniProtKB:P10415 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18449891 | has_input UniProtKB:P10415 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19823025 | has_input UniProtKB:P24385 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21532615 | has_input UniProtKB:P09038 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21885851 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22139073 | has_input UniProtKB:P17096 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23083510 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23083510 | has_input UniProtKB:P24864 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23233752 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24418124 | has_input UniProtKB:P10415 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24418124 | has_input UniProtKB:P19838 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25033200 | has_input UniProtKB:Q9UN37 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25261849 | has_input UniProtKB:P23443 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25594541 | has_input UniProtKB:O14757 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|