WARNING: This summary was generated by AI. MIR16-1 is a microRNA implicated in the regulation of BCL2 expression, which is crucial for cell cycle control and apoptosis [PMC7280959]. It is located on chromosome 13q14, and its deletion, along with miR15a, occurs in the chromosomal deletion del13q often observed in certain cancers [PMC7280959]. Furthermore, MIR16-1 expression has been shown to have a significant direct correlation with the levels of fetal hemoglobin (HbF) in patients treated with hydroxyurea, suggesting a role in the therapeutic response to this treatment [PMC9825386].
ag c - A C u gauu
gucagc ugc uUAGCAGCAC GU AAUAUUGG G uaa c
|||||| ||| |||||||||| || |||||||| | |||
caguug aug AGUCGUCGUG CA UUAUGACC c auu u
ga a U A u u aaaa
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000069 |
| Description | Homo sapiens hsa-miR-16-5p mature miRNA |
| Sequence | 14 - UAGCAGCACGUAAAUAUUGGCG - 35 |
| Evidence |
experimental
cloned [1,3-4,6-8], Northern [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004489 |
| Description | Homo sapiens hsa-miR-16-1-3p mature miRNA |
| Sequence | 56 - CCAGUAUUAACUGUGCUGCUGA - 77 |
| Evidence |
experimental
cloned [8] |
| Database links |
|
| Predicted targets |
|
|