miRBase entry: hsa-mir-16-1

Stem-loop hsa-mir-16-1


Accession
MI0000070
Symbol
HGNC: MIR16-1
Description
Homo sapiens hsa-mir-16-1 precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR16-1 is a microRNA implicated in the regulation of BCL2 expression, which is crucial for cell cycle control and apoptosis [PMC7280959]. It is located on chromosome 13q14, and its deletion, along with miR15a, occurs in the chromosomal deletion del13q often observed in certain cancers [PMC7280959]. Furthermore, MIR16-1 expression has been shown to have a significant direct correlation with the levels of fetal hemoglobin (HbF) in patients treated with hydroxyurea, suggesting a role in the therapeutic response to this treatment [PMC9825386].

Literature search
931 open access papers mention hsa-mir-16-1
(3960 sentences)

Sequence

55980900 reads, 116565.0 reads per million, 188 experiments
gucagcagugccuUAGCAGCACGUAAAUAUUGGCGuuaagauucuaaaauuaucuCCAGUAUUAACUGUGCUGCUGAaguaagguugac
((((((..(((.((((((((((((.((((((((.(.(((..........))).).)))))))).)).)))))))))).)))..))))))

Structure
      ag   c          -  A        C u   gauu 
gucagc  ugc uUAGCAGCAC GU AAUAUUGG G uaa    c
||||||  ||| |||||||||| || |||||||| | |||     
caguug  aug AGUCGUCGUG CA UUAUGACC c auu    u
      ga   a          U  A        u u   aaaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Human miR-16 has been cloned by independent groups [1,2]. This precursor sequence maps to chromosome 13, and was named mir-16 in [1] and mir-16-precursor-13 in [2]. Lim et al. reported 2 identical chromosome 13 loci, which appear to map to the same locus in subsequent genome assemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [3]. A second putative mir-16 hairpin precursor is located on chromosome 3 (MIR:MI0000738).

Genome context
chr13: 50048973-50049061 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-16-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-16-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-16-5p

Accession MIMAT0000069
Description Homo sapiens hsa-miR-16-5p mature miRNA
Sequence 14 - UAGCAGCACGUAAAUAUUGGCG - 35
Evidence experimental
cloned [1,3-4,6-8], Northern [3]
Database links
Predicted targets

Mature hsa-miR-16-1-3p

Accession MIMAT0004489
Description Homo sapiens hsa-miR-16-1-3p mature miRNA
Sequence 56 - CCAGUAUUAACUGUGCUGCUGA - 77
Evidence experimental
cloned [8]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  4. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  5. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  6. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  7. PubMed ID: 12434020
    Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia
    "Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM"
    "Proc Natl Acad Sci U S A (2002) 99:15524-15529

  8. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  9. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540