Mature sequence osa-miR167b

Accession numberMIMAT0000642
IDosa-miR167b
Stem-Loop osa-MIR167b
Sequence
ugaagcugccagcaugaucua
Get sequence
Deep sequencing86903 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).