Mature sequence osa-miR169a

Accession numberMIMAT0000644
IDosa-miR169a
Stem-Loop osa-MIR169a
Sequence
cagccaaggaugacuugccga
Get sequence
Deep sequencing6152 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).