Mature sequence osa-miR169k

Accession numberMIMAT0001056
IDosa-miR169k
Stem-Loop osa-MIR169k
Sequence
uagccaaggaugacuugccug
Get sequence
Deep sequencing5619 reads, 2 experiments
Database links
QuickGO function

References

1