Mature sequence zma-miR160e

Accession numberMIMAT0001374
IDzma-miR160e
Stem-Loop zma-MIR160e
Sequence
ugccuggcucccuguaugcca
Get sequence
Deep sequencing638 reads, 9 experiments

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).