Mature sequence dre-miR-21

Accession numberMIMAT0001787
IDdre-miR-21
Stem-Loop dre-mir-21-1 dre-mir-21-2
Sequence
uagcuuaucagacugguguuggc
Get sequence
Deep sequencing5286827 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).