Mature dre-miR-23a-3p
| Accession | MIMAT0001790 |
| Description | dre-miR-23a-3p mature miRNA |
| Hairpins | |
| Sequence | AUCACAUUGCCAGGGAUUUCCA |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21778427 | has_input UniProtKB:Q9DG41 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21778427 | has_input UniProtKB:Q9DG41 |
| involved_in | GO:0120076 negative regulation of endocardial cushion cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21778427 |
