Mature sequence dre-miR-184

Accession numberMIMAT0001853
IDdre-miR-184
Stem-Loop dre-mir-184-1 dre-mir-184-2
Sequence
uggacggagaacugauaagggc
Get sequence
Deep sequencing728181 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).