Mature sequence dre-miR-190a

Accession numberMIMAT0001854
IDdre-miR-190a
Previous IDsdre-miR-190
Stem-Loop dre-mir-190a
Sequence
ugauauguuugauauauuaggu
Get sequence
Deep sequencing229 reads, 10 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).