Mature sequence dre-miR-462

Accession numberMIMAT0001855
IDdre-miR-462
Stem-Loop dre-mir-462
Sequence
uaacggaacccauaaugcagcu
Get sequence
Deep sequencing566696 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).