Mature sequence dre-miR-194a

Accession numberMIMAT0001858
IDdre-miR-194a
Stem-Loop dre-mir-194a
Sequence
uguaacagcaacuccaugugg
Get sequence
Deep sequencing3297 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).