Mature sequence dre-miR-218a

Accession numberMIMAT0001868
IDdre-miR-218a
Stem-Loop dre-mir-218a-1 dre-mir-218a-2
Sequence
uugugcuugaucuaaccaugug
Get sequence
Deep sequencing5500 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).