Mature sequence ptc-miR156k

Accession numberMIMAT0001900
IDptc-miR156k
Stem-Loop ptc-MIR156k
Sequence
ugacagaagagagggagcac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).