Mature sequence mdo-miR-9a-3p

• Accession number: MIMAT0004088
• ID: mdo-miR-9a-3p
• Previous IDs: mdo-miR-9*
• Stem-Loop: mdo-mir-9a-2 mdo-mir-9a-1 mdo-mir-9a-3
• Sequence: auaaagcuagauaaccgaaagu
• Deep sequencing: 145444 reads, 5 experiments
• Database links:
  • RNAcentral:URS00003496BE_13616
• Predicted targets:
  • TargetScanVert:mdo-miR-9a-3p

References

1. PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).
2. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).