Mature sequence mdo-miR-203

Accession numberMIMAT0004126
IDmdo-miR-203
Stem-Loop mdo-mir-203
Sequence
gugaaauguuuaggaccacuug
Get sequence
Deep sequencing2242 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1