Mature sequence sly-miR169c

Accession numberMIMAT0007920
IDsly-miR169c
Stem-Loop sly-MIR169c
Sequence
cagccaaggaugacuugccga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).