Mature sequence bta-miR-296-3p

Accession numberMIMAT0009273
IDbta-miR-296-3p
Stem-Loop bta-mir-296
Sequence
gaggguugggcggaggcuuucc
Get sequence
Deep sequencing4709 reads, 67 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2