Mature sequence tca-bantam-3p

Accession numberMIMAT0010091
IDtca-bantam-3p
Previous IDstca-bantam
Stem-Loop tca-bantam
Sequence
ugagaucauugugaaagcugauu
Get sequence
Deep sequencing reads, experiments
Database links
QuickGO function

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).