Mature sequence cel-miR-2209a-5p

Accession numberMIMAT0011431
IDcel-miR-2209a-5p
Previous IDscel-miR-2209a*
Stem-Loop cel-mir-2209a
Sequence
gaguguaaccacucuucuccuuc
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1