Mature sequence osa-miR2118q

Accession numberMIMAT0011756
IDosa-miR2118q
Stem-Loop osa-MIR2118q
Sequence
uucccgaugccuccuauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).