Mature sequence bdi-miR1127

Accession numberMIMAT0012190
IDbdi-miR1127
Stem-Loop bdi-MIR1127
Sequence
aacuacucccuccguccgaua
Get sequence
Deep sequencing reads, experiments

References

1