Mature sequence eca-miR-194

Accession numberMIMAT0013050
IDeca-miR-194
Stem-Loop eca-mir-194-1 eca-mir-194-2
Sequence
uguaacagcaacuccaugugga
Get sequence
Deep sequencing50 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).