Mature sequence cqu-miR-1174

Accession numberMIMAT0014354
IDcqu-miR-1174
Stem-Loop cqu-mir-1174
Sequence
cuggguauuuuagaucaucggc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).