Mature sequence gga-miR-2954

Accession numberMIMAT0014448
IDgga-miR-2954
Stem-Loop gga-mir-2954
Sequence
cauccccauuccacuccuagca
Get sequence
Deep sequencing249606 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20220842 "Somatic sex identity is cell autonomous in the chicken" Zhao D, McBride D, Nandi S, McQueen HA, McGrew MJ, Hocking PM, Lewis PD, Sang HM, Clinton M Nature. 464:237-242(2010).