Mature sequence zma-miR156b-3p

Accession numberMIMAT0015127
IDzma-miR156b-3p
Previous IDszma-miR156b*
Stem-Loop zma-MIR156b
Sequence
gcucacccucuaucugucagu
Get sequence
Deep sequencing100 reads, 33 experiments

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).