Mature sequence bmo-let-7-3p

Accession numberMIMAT0015221
IDbmo-let-7-3p
Previous IDsbmo-let-7*
Stem-Loop bmo-let-7
Sequence
cuguauagccugcuaacuuucc
Get sequence
Deep sequencing35 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:17651473 "Characterization and expression patterns of let-7 microRNA in the silkworm (Bombyx mori)" Liu S, Xia Q, Zhao P, Cheng T, Hong K, Xiang Z BMC Dev Biol. 7:88(2007).
3
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
4
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).