Mature sequence zma-miR397b-3p

Accession numberMIMAT0015353
IDzma-miR397b-3p
Previous IDszma-miR397b*
Stem-Loop zma-MIR397b
Sequence
ccagcgcugcacucaauuacg
Get sequence
Deep sequencing29 reads, 9 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).